1. Field of the Invention
The invention relates to the fields of nucleic acid polymerases and nucleic acid polymerization reactions.
2. Introduction
The efficiency of a nucleic acid polymerization reaction has implications for numerous assays and techniques. For example, the ability to enhance polymerase activity in a PCR process increases the sensitivity of the PCR-based assay. We have identified, produced, purified, and analyzed novel extracts, proteins, and complexes that improve the polymerization activity of nucleic acid polymerases. Included within the aspects of the present invention are methods for identifying compositions with a polymerase enhancing activity, methods for purifying and using these compositions, and specific extracts, proteins, and complexes that function to enhance polymerase activity.
3. Description of Related Art
Manipulating nucleic acids with polymerization reactions is a fundamental component of biotechnology-related research. These reactions permit researchers to replicate DNA or RNA in vitro, which in turn allows cloning or amplification of specific nucleic acids or groups of nucleic acids. Numerous other examples exist detailing the critical nature of a nucleic acid polymerization reaction or a nucleic acid polymerization enzyme in a particular technique, including sequencing nucleic adds, mutagenesis of nucleic acid sequences, and producing nucleic acid probes for hybridization. Of particular current interest are amplification reactions, such as PCR, that have greatly increased the rate at which researchers can perform nucleic acid related experimentation. Extremely rare nucleic acids can now be amplified and manipulated using these techniques, which necessarily involve nucleic acid polymerases.
Using techniques with an amplification step has driven concern for the efficiency, fidelity, and sensitivity of the polymerase used. This has resulted in efforts to both analyze and optimize polymerization conditions for a variety of applications. (Lundberg et al., Gene 108: 1-6 (1991); Eckert and Kunkel, PCR Methods Applic. 1: 17-24 (1991); Ling et al., PCR Methods Applic. 1: 63-69 (1991); Brail et al., Mutat. Res. 303: 75-82 (1994); Garrity and Wold, P.N.A.S. 89: 1021-1025 (1992); Taylor and Logan, Curr. Opin. Biotechnol. 6: 24-29 (1995)) In particular, quantitative amplification-based reactions rely upon the ability to efficiently amplify each nucleic acid species present in a sample. (See Ausubel, et al., Chapter 15, In: Current Protocols in Molecular Biology, John Wiley & Sons (1992) and supplements through 1995.) Thus, both a concern for the accuracy of and a need for new methods to enhance the performance of amplification-based nucleic acid techniques exists in the art.
One way in which these concerns and needs have been addressed is through the use of additives to the amplification reaction. Different additives act at different points in the amplification process. For example, formamide has been used to increase the specificity of PCR with GC rich target sequences, which are particularly susceptible to intramolecular hybridization that may prevent hybridization with a primer. (Sarkar, G. et al. Nucl. Acids Res. 18: 7465 (1990)). It has also been reported that tetramethylammonium chloride increases yield and specificity of PCR reactions. (Chevet, E., et. al., Nucleic Acids Res. 23:3343-3334 (1995).) Hung et al. report the reduction in multiple satellite bands from amplifying complex DNA when dimethyl sulfoxide (DMSO) is added. (Hung, T., et al. Nucl. Acids Res. 18: 4953(1990).) The multiple satellite bands often present problems in purifying the desired amplification product from the other DNA present.
Certain proteins have been used to stabilize hybridized nucleic acids during replication. For example, E. coli single-stranded. DNA binding protein has been used to increase the yield and specificity of primer extension reactions and PCR reactions. (U.S. Pat. Nos. 5,449,603 and 5,534,407.) The gene 32 protein (single stranded DNA binding protein) of phage T4 apparently improves the ability to amplify larger DNA fragments (Schwartz, et al., Nucl. Acids Res. 18: 1079 (1990)) and enhances DNA polymerase fidelity (Huang, DNA Cell. Biol. 15: 589-594 (1996)). In addition, bacterial thioredoxin combined with T7 DNA polymerase (Sequenase™; Amersham-USB) has been used to increase processivity, but the combination is not active at high temperatures, such as those used in PCR.
Another way amplification-based assays and techniques have been improved is through the development of modified polymerases or the use of combinations of polymerases. (U.S. Pat. No. 5,566,772) For example, the TaKaRa long PCR kit employs two polymerases (Takara Shuzo Co., Ltd; Japan), and a number of polymerase combinations were also tested by Bames (Proc. Nat. Acad. Sci. USA, 91:2216-2220 (1994). Truncated Taq and T. flavus DNA polymerase A enzymes that apparently exhibit increased thermostability and fidelity in PCR have also been suggested. (U.S. Pat. No. 5,436,149.) Combinations of polymerases with and without 5′-3′ exonuclease or 3′-5′ proofreading activity have also been used. (U.S. Pat. No. 5,489,523)
Further, amplification-based assays and techniques have been improved through empirical testing of conditions, reagents, and reagent concentrations to optimize polymerization reactions with a particular enzyme. Temperature and length of amplification cycles, primer length, and pH, for example, are all conditions that can be optimized. (Bames, Proc. Nat. Acad. Sci. USA, 91:2216-2220 (1994).)
However, accessory proteins can be even more useful in improving polymerase activity and/or the processivity of polymerases. “Processivity” in this context refers to the number of enzymatic reactions occurring each time an enzyme binds to its substrate. In the context of nucleic acid replication reactions, “processivity” means the number of bases that can be replicated when the polymerase binds to a priming site. An increase in processivity directly relates to longer replication products.
Intracellular replication has been shown to involve accessory proteins, as characterized in E. coli, human, and phage T4 systems. The accessory proteins interact with polymerases to improve activity and provide the high processivity necessary to replicate genomic DNA efficiently while avoiding unacceptable mutation rates. Since the accessory proteins can be used in combination with the other improvements noted above, the development and application of accessory proteins holds particular promise for enhancing the results of nucleic acid replication-based reactions.
Accessory proteins have been identified in eukaryotes, E. coli, and bacteriophage-T4 and are thought to form “sliding clamp” structures. (Kelman and O’Donnell, Nucl. Acids. Res. 23(18): 3613-3620 (1995).) These structures are thought to tether the polymerase to DNA, thereby increasing processivity. The sliding clamp structures, however, have largely been studied in in vitro model systems. Only in the case of T4 polymerase has knowledge of the activity of such accessory proteins been used to improve polymerization-based techniques employed by researchers in the art. For example, accessory proteins of the T4 holoenzyme have been reported to improve processivity when added to polymerization systems using T4 polymerase. (Young et al., Biochem. 31(37): 8675-8690 (1992); Oncor Fidelity™ Sequencing System, Oncor; Gaithersburg, Md.) However, since the T4 accessory proteins are derived from bacteriophage, they are not likely to enhance polymerases from bacteria, archae, or eukaryotes. Thus, the use of T4 accessory proteins is believed to have been limited to techniques where T4 polymerase is used.
The presence of dUTP (deoxyuracil triphosphate) in a polymerization reaction and the effect of deoxyuridine-containing DNA on DNA synthesis have also been examined. In particular, deoxyuridine in a DNA strand has been shown to inhibit polymerization by archael DNA polymerases. (Lasken, et al., (1996)
Accordingly, since present knowledge and use of accessory proteins has led to limited applications in replication-based techniques, there continues to exist a need in the art for new and more widely useful compositions for enhancing polymerase enzyme activity. The present invention meets this need.
The present invention comprises extracts, protein complexes, and related proteins that possess nucleic acid polymerase enhancing activity useful in a variety of replication reactions known in the art. Thus, the extracts, protein complexes, and related proteins of the invention function to enhance a wide spectrum of in vitro nucleic acid replication reactions by providing, inter alia, replication products of superior length, fidelity or both, and at higher yields. As used in this specification and appended claims “polymerase enhancing activity” means the ability to increase the rate, fidelity, and/or yield of a nucleic acid polymerization reaction mediated by a nucleic acid polymerase, or to expand or alter the range of conditions under which such reaction does or may proceed.
In one aspect of the invention, extracts of
In another aspect of the invention, PEF complexes are provided. The PEF complexes of the invention possess polymerase enhancing activity and generally comprise multiple protein subunits with a combined molecular weight of approximately 250 kD or above as determined by SDS-PAGE analysis and gel filtration of unheated PEF samples. An example of one PEF complex (P300) was purified from Pfu cell sample extracts. The predominant components of the complex are a 50 kD protein (P50) and a 45 kD protein (P45). Heat treating the Pfu P45 with 2% SDS and 1% TCA produces a 17-18 kD protein, which represents the fully denatured form. However, the Pfu PEF complex contains other minor components with approximate apparent molecular weights of 150, 100, 85, 60, 55, 42, and 37 kD. At least two components (150 and 100) have been shown to be dimeric or polymeric forms of P50. Thus, the PEF complexes of the invention comprise protein components and function to enhance the activity of polymerases.
In another aspect of the invention, Pfu proteins possessing polymerase enhancing activity are provided. These proteins have molecular weights between approximately 42 and 60 kD by SDS PAGE analysis under partially denaturing conditions. The 42-60 kD proteins may be used alone or in combination to enhance polymerase activity. Methods for purifying these proteins as well as the PEF extracts and PEF complexes from which they have been isolated are also provided.
The invention also involves two particular proteins, Pfu P50 and P45, which are predominant components of the PEF complex (P300). Detailed structural and functional information on the Pfu P45 and P50 proteins is disclosed. The P50 protein is similar in structure to a bacterial flavoprotein. The P45 protein is similar in structure to dCTP deaminase, functions as a dUTPase, and possesses polymerase enhancing activity. The structural information herein can be used to generate specific hybridization probes that detect the presence of nucleic acids encoding a protein that is part of a PEF complex, or related proteins from samples from other species, or possesses PEF activity. Furthermore, the structural information can be used to generate proteins from expression systems known in the art, synthetic proteins, partially synthetic proteins, or proteins made from a combination of natural proteins, expressed proteins, and synthetic proteins. Methods for detecting the presence or absence of polymerase enhancing activity and/or dUTPase activity are also included in this invention and can be used to identify the various active PEF proteins or analogs. In addition, polyclonal or monoclonal antibodies that bind to PEF components can be produced, for example from purified P45 or P50, purified PEF complexes (P300), or another PEF of the invention. These antibodies can then be employed in assays and kits, well known in the art, in order to identify the presence or absence of a PEF.
The understanding of the catalytic activity of PEF, and the P45 protein in particular, provides aspects of this invention directed to polymerase enhancing proteins, as well as methods, kits, and compositions containing a dUTPase activity or dUTPase protein as a PEF. Thus, a dUTPase activity or dUTPase protein or composition can be used to enhance nucleic acid replication, polymerization, or PCR reactions according to this invention. In fact, any activity that functions to turn-over dUTP can be used as a polymerase enhancing activity of this invention. Wide-ranging sources for the dUTPase activity, protein, or composition exist, as it is demonstrated to be present from both archael and human sources, the ends of the phytogenetic possibilities. Thus, any cell or species can be used as a source for polymerase enhancing activity or PEF.
Kits for replicating nucleic acids and methods for using the PEF complexes, specific proteins of the complexes, and extracts containing PEF are also provided. In addition, the complexes, proteins, and extracts can be used in compositions comprising a polymerase. Ideally, the polymerase will be one that is enhanced by the complex, protein, or PEF. The PEF extracts, complexes and proteins of the present invention are particularly useful in mixtures with nucleic acid polymerases, such as native polymerases, those produced by recombinant DNA techniques, and kits containing such polymerases.
Also provided in the invention are methods for identifying proteins or complexes that influence nucleic acid polymerases. The source of the protein can be any bacterial, archael, or eukaryotic species. Certain embodiments involve methods for identifying proteins affecting polymerases used in amplification reactions, for example, alpha-type DNA polymerases such as DNA polymerases from
FIG.
PCR enhancing activity was measured using the 6.2 kb system described in example 1. Column fraction SCS #36 H.S. #78 (prep. 2) was diluted in 1× cloned Pfu PCR buffer and 1 μl aliquots of the following were added to 100 μl PCRs. FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
The PCR enhancing activity contained in 1 μl of each column fraction (fractions 1-93 from
The following description should not be construed to limit the scope of this invention to any specifically described embodiment. Various aspects and embodiments of this invention will be apparent from the disclosure as a whole in context with the knowledge of one skilled in the art. In addition, the description herein, in combination with information known or available to persons of ordinary skill in the art, enables the practice of the subject matter encompassed by the following claims.
For the purposes of this invention, a nucleic acid replication reaction can mean any of the numerous nucleic acid amplification, primer extension, reverse transcription, or other nucleic acid polymerization reactions known in the art. Additionally, a replication reaction of this invention includes any reaction in which the ability of an enzyme to interact with a first nucleic acid and generate a second, substantially complementary nucleic acid sequence, is involved. The amplification reactions of this invention are not limited to PCR processes or any particular PCR-based assay, although they are particularly useful herein, and specifically include RT-PCR processes. The proteins, preparations, compositions, mixtures, kits and methods of this invention can be used with any appropriately designed nucleic acid replication reaction.
As used herein, the term “PEF” refers to a naturally occurring protein derived from a bacterial, eukaryotic, or archael source (or a wholly or partially synthetic copy or analog thereof) having polymerase enhancing activity, mixtures of one or more such proteins, protein complexes containing one or more such proteins, or extracts containing one or more of such proteins, mixtures or complexes Recombinant PEF proteins, as a wholly synthetic copy of a naturally occurring protein, and complexes with at least one recombinant PEF protein are also “PEFs” according to this invention. The Pfu P45 and P50 proteins of this invention are illustrative of PEF proteins, which exhibit an apparent molecular weight of approximately 45 kD and 50 kD and are predominant components of a PEF complex derivable from Pfu. Data relating to both the P45 and P50 proteins is presented herein and details specific structural information. On SDS-PAGE, the non-heat-treated PEF complex containing P45 and P50 as well as minor additional components migrates with an apparent molecular weight>250 kD. One species of the PEF complexes of this invention is the P300 complex from
The present invention is intended, however, to encompass other PEF proteins, mixtures, complexes, compositions, and extracts derived from organisms other than Pfu identified by techniques analogous to those provided by the following examples, or by use of the structural information on the PEF proteins described herein or derivable from the proteins described herein. More specifically, the invention is intended to encompass PEFs identified on the basis of sequence homology to all or part of the PEFs described herein, including nucleic acid homology to all or part of the DNA sequence encoding the proteins described herein or the DNA sequences described herein. Computer-implemented homology searches using the sequence information herein, stored on an appropriate computer-readable medium, with procedures known in the art, can generate these homologous PEFs. Also, reactivity with antibodies to the proteins, complexes, or extracts disclosed herein can be used with procedures known in the art to generate homologous PEFs.
One skilled in the art is familiar with methods of generating analogs of proteins. Various techniques from publications in the art can be used to mutate, modify, truncate, or otherwise change a protein’s amino acid sequence and retain functional activity. In the case of a dUTPase activity as PEF, the known crystal structure of dUTPases, such as
Furthermore, a PEF can also be a protein exhibiting a dUTPase activity, as demonstrated herein. Specifically, human,
The polymerase enhancing activity of the PEFs of this invention can be determined in a number of different ways. The description below details a few examples of assays and techniques one skilled in the art can use to determine if PEF activity is present. These assays and techniques can be used alone or in combination.
Example 1 specifically details screening assays and the “on/off” assay. This type of PCR assay allows one to identify the presence of a polymerase enhancing activity in a sample. More generally, any assay that shows an increase in PCR product yield, over a negative control level, when a sample suspected to contain a polymerase enhancing activity is added can be used to identify a polymerase enhancing activity. Also, any assay that shows an increase in processivity, over a control level, reflected by the increased length of PCR products being generated when a sample suspected to contain a polymerase enhancing activity is used. A combination of PCR product yield and increased processivity can also be used to determine whether or not a polymerase enhancing activity is present.
A polymerase enhancing activity can also be identified by assays that indicate a reduction in the PCR inhibitory action of incorporated dUTP. For example, PCR reactions can be conducted in the presence of dUTP and samples suspected of containing polymerase enhancing activity. Those reactions that allow polymerization in the presence of dUTP indicate a polymerase enhancing activity in the form of a dUTPase activity. Thus, a dUTPase activity can be a polymerase enhancing activity.
Also, a composition that functions to turn-over dUTP, especially under thermophilic reaction or PCR reaction conditions, can be a polymerase enhancing activity as a dUTPase. An enzyme or activity that acts on dUTP so that it is not incorporated into a newly polymerized strand functions to turn-over dUTP. The turn-over of dUTP can also be detected by an assay for the conversion of dUTP into dUMP, as detected by analyzing the reaction products by HPLC, for example. Biochemical assays that detect the conversion of dUTP into dUMP, or other nucleoside phosphate or metabolic derivatives or products, can be devised or are known in the art and can be used to identify polymerase enhancing activity as a dUTPase activity.
A polymerase enhancing activity can also be a dUTPase enzyme that possesses the consensus uridine-binding sequence motif (SEQ ID NO.: 72). A number of those enzymes are identified below. However, numerous others exist or can be identified through computer-implemented or other sequence analysis procedures known in the art. Thus, the presence of the consensus uridine-binding motif or the related sequences shown herein can also be used to define an enzyme or protein that is a PEF, such as a protein that comprises SEQ ID NO.: 72, or any one of SEQ ID NOs.: 72-81, or combinations of these sequences.
Also, proteins identified through sequence identity comparisons known in the art can be used to confirm the presence of a PEF. For example, proteins from one species possessing a sequence identity of approximately 18% or greater have been shown in the art to be related to or analogous to the known protein of another species. In the examples below, a sequence similarity of approximately 39% suffices to positively identify a dUTPase activity that can act as a PEF.
The antibodies to PEF described herein can also identify a protein with polymerase enhancing activity. For example, Western blot analysis of compositions from various archeal, bacterial, thermophilic bacterial, or eukaryotic samples can identify a protein that possess polymerase enhancing activity. Furthermore, as the PEF proteins and complexes of this invention are demonstrated as immunogenic, various other antibodies to PEF may be produced by techniques known in the art with the information herein. These other antibodies can also be used to identify a PEF.
Protein-containing extracts from a number of different sources can be tested for PEF activity. The extracts can be prepared in a number of ways known in the art.
One method was demonstrated with Pfu DSM 3638 cells. The cells were grown, a cell paste collected by centrifugation and then frozen at −80° C. The paste was taken up with lysis buffer [50 mM Tris-HCI (pH 8.2), 1 mM EDTA, 10 mM B-mercaptoethanol, 0.5 mM PMSF, and 2 μg/ml aprotinin], and thereafter the cells were lysed in a French press and then sonicated. Following sonication, the lysate was centrifuged and the supernatant, containing potential PEFs, was collected for assays.
Extracts from any cell producing a PEF, for example, cells transfected with a recombinant vector directing the expression of a PEF, can also be assayed. Methods of making extracts of these cells are known in the art and are exemplified below.
One method of detecting thermostable PEFs is by screening partially-purified fractions from thermophilic archeal or bacterial extracts for PCR enhancing activity. PCR enhancing activity can be detected in samples consisting of column-purified fractions as well as homogeneous protein samples and proteins recovered by elution from SDS-PAGE gel slices (see below). Samples are added to PCR amplification reactions containing DNA polymerase, buffer, dNTPs, primers, and DNA template. PCR enhancing activity is identified by an increase in PCR product yield for amplifications conducted in the presence of a particular sample (DNA polymerase+PEF) as compared to amplifications conducted in the absence of added sample (DNA polymerase only).
When screening samples suspected of containing endogenous DNA polymerase activity, for example protein extracts, negative controls can be performed in which the exogenous DNA polymerase has been omitted from the PCR amplifications. In addition, when screening samples contaminated with DNA, negative controls can be carried out in which exogenous DNA template is omitted from the PCR amplifications.
The sensitivity of the PCR enhancing assay is dependent on the complexity of the DNA targets employed. PCR reaction parameters (target complexity, DNA template concentration, polymerase concentration, PCR cycle number or extension time) can be adjusted so that the yield of PCR product is barely detectable under normal conditions. in addition, samples for testing can be diluted appropriately so that the concentration of PEFs falls within the detectable range of the PCR enhancing activity assay.
A number of amplification assays can be designed to detect the presence or absence of PEF activity, and/or compare PEF activity between samples. Generally, these tests employ a sample containing a rare sequence to be amplified. The sequence is so rare, or the conditions so designed, that amplification under normal situations results in barely detectable or no detectable amplified product. By adding a sample with putative PEF activity, any effects on the amount of amplified product formed can be detected.
One particular screening assay is called the “On/Off” assay, which detects the presence or absence of PEF. The ”On/Off” assay results in appreciable amplified product only when PEF activity is present, or a detectable difference in amplified product when PEF activity is present compared to when PEF is not present. Methods for detecting the amount of amplified product are known in the art and include those using electrophoresis and hybridization.
One embodiment of an assay used to screen for PEFs, in this case from
A second embodiment of an assay to screen for PEF employs, for example, the 5.2 kb human α1-antitrypsin gene in a PCR amplification. PCR amplification of this primer/template system was so limited that, in the absence of PEF, it was difficult to detect any PCR product. With added PEF activity, a 5.2 kb product was easily detected. The following conditions were used for this “On/Off” assay: In 100 μl-1×Cloned Pfu DNA polymerase buffer, 200 μM each dNTP, 200 ng primer F-91-23, 200 ng primer R5271-21, 125 ng Human Genomic DNA, 2.5 units cloned Pfu DNA polymerase, +/− PEF or recombinant P45 (rP45).
Primer F91-23 5′ GAGGAGAGCAGGAAAGGTGGAAC 3′ (SEQ ID NO: 64)
Primer 5271-21 5′ GCTGGGAGAAGACTTCACTGG 3′ (SEQ ID NO: 65)
The PCR cycling conditions were as follows: 95° C. for 1 minute (1 cycle), 95° C. for 1 minute −60° C. for 1 minute −72° C. for 10 minutes (30 cycles). After completion, the reactions are run out on an electrophoresis gel and the quantity of reaction products determined by any of a number of methods known in the art.
Extracts can also be added to any nucleic acid replication reaction to determine PEF activity. Many of these reactions are known in the art, including primer extension reactions, DNA sequencing reactions, site-directed mutagenesis reactions, and a number of PCR-based reactions. (Ausubel, F. M., et al. (1989) Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Interscience, New York, N.Y.; Sambrook, J., et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) By comparing the results produced in a nucleic acid replication reaction with and without the added extract, one can identify the presence of PEF.
Once PCR enhancing activity has been detected from, for example, archeal or bacterial sources, large amounts of purified PEF can be obtained by column chromatography. The following protocol was developed for purifying PEF from
The supernatant was loaded at a flow rate of 5 ml/min. onto a 10×5 cm Q-Sepharose Fast Flows™ (Pharmacia) column (≈392 m/s), pre-equilibrated in buffer consisting of 50 mM Tris-HCI (pH 8.2), 1 mM EDTA, and 10 mM B-mercaptoethanol. The column was washed with 2 column volumes of buffer, and the pass-through and column washes were collected and pooled. The pooled fractions were adjusted to pH 7.5 using 1 N HCI.
The Q-Sepharose pass-through was then loaded at a flow rate of 5 ml/min. onto a 5×11.5 cm (≈225 mls) SP Sepharose Big Bead™ (Pharmacia) column, equilibrated in buffer containing 50 mM Tris-HCI (pH 7.5), 1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol, 0.1% (v/v) Igepal CA-630, and 0.1% (v/v) Tween 20. The column was washed with equilibration buffer until the absorbance (OD
Some of the fractions analyzed by SDS-PAGE showed a band >250kD when a sample was not heated prior to electrophoresis (≈300 kD). The fractions containing the 300 kD band were pooled and dialyzed overnight against 2×4 liters of Buffer A [50 mM Tris-HCI (pH 8.2), 1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol, 0.1% (v/v) Igepal CA-630, and 0.1% (v/v) Tween 20]. The dialyzed pool was loaded at a flow rate of 2 ml/min. onto a 2.6×29 cm (≈154 mls) Heparin Sepharose CL-6B™ (Pharmacia) column, equilibrated in Buffer A. The column was washed with 1 liter of Buffer A, and then eluted with a 1.5 liter gradient from 0 to 300 mM KCI/Buffer A. Fractions of 10 ml were collected, and aliquots removed from every third tube for SDS-PAGE analysis. Fractions containing the 300 kD band were pooled and dialyzed overmight against 2×4 liters of Buffer A.
The heparin sepharose-purified pool was loaded at a flow rate of 0.5 ml/min. onto a 1.6×95 cm (≈191 m/s) Sephacryl S-200 High Resolution™ (Pharmacia) column equilibrated in Buffer A containing 100 mM KCI. Then, 2 ml fractions were collected and aliquots removed from every third tube for SDS-PAGE analysis. Fractions containing the 300 kD band were pooled and dialyzed overnight against 1 liter of buffer containing 50 mM Tris-HCI (pH 8.2), 0.1 mM EDTA, 1 mM DTT, 50% (v/v) glycerol, 0.1% (v/v) Igepal CA-630, and 0.1% (v/v) Tween 20. The purified protein was stored at −20° C. The purification protocol described above yielded ≈1 mg. of relatively homogeneous P300 band from 500 g. of cell paste.
PEF in a heterogeneous sample can be identified by eluting purified protein from SDS-PAGE gel slices and rescreening for PCR enhancing activity. This method allows rapid assessment of the number of PER proteins in a particular sample and identification of their apparent molecular weight.
Gel slices containing PEFs are identified by testing the eluates for PCR enhancing activity. Eluates containing >0.1 ng/μl PEF are then re-analyzed on silver-stained SDS-PAGE gels to verify the apparent molecular weight of the predominant protein component. The gel slice eluates are boiled in the presence of 2% SDS before loading and the apparent molecular weights of PEF proteins determined relative to protein standards. The gel slice elution procedure described here allows recovery of 1-10% of the protein of interest.
The fractions collected after the heparin sepharose chromatography were analyzed for PEF activity using the PCR screening assay (Example 1). The addition of diluted heparin sepharose fraction dramatically increased yields of PCR products generated with cloned Pfu DNA polymerase. The PCR enhancing activity of the fractions was shown to be dependent upon the presence of exogenous DNA template (
In order to further characterize the factor or factors responsible, the following was performed. PEFs after heparin sepharose chromatography were identified by screening SDS-PAGE gel-purified samples for PCR enhancing activity, as discussed above in Example 2. When the protein samples were loaded onto SDS-PAGE gels without pre-boiling, PCR enhancing activity (
The proteins eluted from the gel slices were also screened for DNA polymerase activity to demonstrate that PCR enhancing activity was not related to contaminating DNA polymerase activity (FIG.
The
However, when the proteins eluted from gel slice #2 are boiled in SDS prior to loading, the predominant component migrates with an apparent molecular weight of 50 kD (FIG.
P. furiosus PEF fractions following S200 chromatography comprises a mixture of proteins. A discrete band in SDS-PAGE migrates above the 250 kD marker when the sample is not heated prior to electrophoresis. This protein is called P300 or PEF complex. When the conditions are changed to substantially dissociate the PEF complex, the subunit protein components of the PEF complex are visualized in SDS-PAGE.
One method of dissociating PEF complex into its component proteins is heat treatment. In the absence of heating, the majority of PEF migrates as a complex, running slightly slower than the 250 kD molecular weight marker. Minor amounts of dissociated P50 and P45 are visible in the unheated sample. However, after heat treatment at temperatures of about 85° C. or higher, the PEF complex is completely dissociated as indicated by the absence of the 300 kD band by SDS-PAGE. The predominant protein component of PEF complex, as visualized by silver-staining, exhibits an apparent molecular weight of approximately 50 kD in SDS-PAGE. The P50 band is shown in the gel of
Protein components of S200-purified PEF were purified by SDS-PAGE and the PCR enhancing titer was determined by adding serial dilutions of each gel slice eluate to PCR reactions with cloned Pfu DNA polymerase PCR reactions. The protein or protein mixtures which exhibited the highest levels of polymerase enhancing activity were identified by running the eluates on silver stained SDS-PAGE gels. Analysis of SDS-PAGE gel slice eluates indicates that PCR enhancing activity of S200-purified
Titration experiments showed that the PCR enhancing titer of gel purified proteins migrating with apparent mass between 42 kD and 60 kD was not significantly different from that of the gel-purified PEF complex (300 kD band). The levels of PCR enhancing activity migrating between the 148 and 60 kD markers were insignificant, thereby indicating that the 85 kD, 100 kD, and 150 kD bands do not contribute substantially to full PCR enhancing activity of the PEF complex (P300). Moreover, these components do not appear to further enhance the activity of PEF.
The complex and the predominate 50 kD component (P50) and 45 kD (P45) component from Pfu were sequenced at the N-terminus. In addition, N-terminal sequence analysis was performed on the minor 100 and 150 kD components generated upon heat dissociation. Two analyses were performed. In the first study, heparin sepharose-purified PEF samples (≈20% homogeneous; prep. 4 in
The N-terminal amino acid sequences of the PEF complex (P300) and the 50 kD component (Pfu P50) were found to be substantially identical (Table A). This data confirmed that Pfu P50 is the predominant component of the PEF complex. Two distinct sequences were found for both P300 and P50 (1° and 2°), suggesting that Pfu PEF may contain 2 different 50 kD species which co-migrate, or that the PVDF strip containing the 50 kD species was contaminated with the 45 kD species or other species visible by SDS-PAGE.
In addition to the N-terminal sequencing, the 50 kD protein was also subject to in situ trypsin digestion and microbore reverse HPLC. A subset of tryptic peptides was analyzed by mass spec. Two peptides with single masses (#107, #112) and one peptide with two masses (#108) were chosen for sequence analysis. Two internal peptide sequences from Pfu P50 were recovered (Table A; Tryptic Peptides). Peptide #112 was 24 amino acids in length and the calculated mass of the Edman sequence (2530.8) was in very good agreement with the observed peptide mass (2531.7). Peptides #107 and #108 contained multiple sequences which could not be sorted by Edman sequencing alone. However these peptide fractions eluted very close together on microbore HPLC and contained several residues in common. Based upon shared sequence and mass analysis, a tentative sequence was assigned ({fraction (107/108)}; Table A).
The 35 amino acid sequence recovered from the N-terminus of Pfu P50 (SEQ ID NO.: 3), and the two internal peptides of 17 and 24 amino acids (SEQ ID NO.:s 5 and 6), represent approximately 16% of the total amino acid sequence of Pfu P50, assuming an apparent molecular weight of 50 kD and a length of approximately 454 amino acids.
In the second round of analyses, the N-terminal sequences of the 150, 100, 50, 45, and 42 kD species were determined from a PVDF blot of heated S200-purified PEF (FIG.
Using sequence information stored in a computer readable medium, one skilled in the art can perform computer-implemented homology searches. Here, the nonredundant GenBankCDS translations+PDB+SwissProt+SPupdate+PIR protein databases, using BLASTp, indicated that the partial amino acid sequence of Pfu P50 and P45 do not exhibit identity to any protein in those databases.
The nucleotide sequence of the P50 protein component was obtained by cloning the Pfu P50 using standard techniques.
A
After treatment, the filters were partially dried until they were still damp, but no standing water was visible. The DNA on the filters was fixed by UV crosslinking with the Stratalinker set to the “Autolink” format.
The filters were prehybridized in 15 ml of:
5× SSC
40 mM NaPO
5× Denhardt’s
5% Dextran Sulfate
50% Formamide
0.1 mg/ml Salmon sperm DNA (Boiled separately and added immediately prior to use) Prehybridization was carried out at 42° C. for approximately 2 hours.
Probe was generated from the 900 bp PCR product amplified from Pfu genomic DNA with the following degenerate primers:
Oligo #50 was designed to hybridize to DNA encoding the HHVKLIYA (SEQ ID NO.: 66) peptide in SEQ ID NO.: 1, at the N-terminus of P50, while oligo #61 was designed to hybridize to the antisense DNA strand encoding the peptide KYDAVIMA (SEQ ID NO.: 67) in SEQ ID NO.: 5.
The PCR product was purified from free primers, buffer and nucleotides and 50 ng was labeled with
Hybridization was allowed to continue overnight at 42° C. before the hybridization solution was removed and the filters were washed four times with 0.1× SSC, 0.1% SDS at 60° C. (stringent conditions).
The filters were exposed to X-ray film overnight and 20 primary isolates, with strong signals on both replicate filters, were picked.
Six primary isolates were diluted, plated, and screened again using the same method described above. Of the six, three filters produced isolated lambda clones. The clones were confirmed by PCR amplification using the degenerate primers. All clones were able to produce the 900 bp amplified product with oligos #50 and #61, which was used as probe. Clones 6A and 3B produced a 1200 bp amplified fragment with oligos #54 and #58. Oligo #54 was designed to hybridize to DNA encoding the HHVKLIYA (SEQ ID NO: 66) peptide in SEQ ID NO: 1, and oligo #58 was designed to hybridize to the antisense DNA strand encoding the EENQVVL (SEQ ID NO.: 68) peptide of SEQ ID NO.: 6. Clone 6D only produced a 900 bp amplified product.
Bluescript plasmid was excised from the lambda clones in SOLR cells and the presence of inserts confirmed again by PCR amplification of the 1200 or 900 bp product.
Sequencing was carried out on purified PCR products and plasmid mini-preps made from the excised cells. The nucleotide sequence is listed below with the predicted protein translation. The peptde sequences used to generate the probes are indicated by underlining. “N” represents any base and “X” represents any amino acid.
Translated sequence corresponding to chemically-determined N-terminal sequence (SEQ ID NO.: 3):
MLHHVKLIYATKSRKLVGKKIVXXXPGSIAA (SEQ ID NO: 46)
Translated sequences corresponding chemically-determined internal peptide sequences (SEQ ID NOs.: 5 and 6):
KYDVVIMAAAVSDFRPK (SEQ ID NO: 47)
ADLVVGNTLEAFGSEENQVVLIGR (SEQ ID NO: 48)
The protein has a theoretical pl of 9.36 and a theoretical MW of 44801.29.
There are inconsistencies between the chemically-determined AA sequence of P50 and the AA sequence derived from the
Some of the inconsistencies and explanations are:
The inconsistency in Table A sequence at cycle 2 (extra AA between AA1 and 2) may be due to contamination with P45, which appears to have L’s at positions 2 and 3. Moreover, L at cycle 2 in SEQ ID NO: 1 was assigned tentatively. Other inconsistencies between the Table A sequence and the predicted sequence occur at AA 15 (R vs. K) and AA 32-34 (VEP vs. LDV).
An inconsistency between the Table B sequence and the predicted sequence was found at AA13. The identification of AA13 as L instead of S is explained by the poor recovery of S in chemical sequencing and the contamination of P50 with low amounts of P45, which has a L at that position.
SEQ ID NO: 6, determined chemically from a P50 tryptic peptide, was identical to a 24 AA sequence translated from the P50 DNA sequence. For SEQ ID NO: 5, there were 2 inconsistencies found between the chemical and DNA sequences. An A was recovered at cycle 4 instead of a V, and a V was recovered at cycle 12 instead of a S. The inconsistencies may be due to the difficulties associated with interpreting sequences from a sample that is not absolutely pure.
The DNA sequence of a P50 clone exhibits very strong, homology to the flavoprotein DFP, a protein identified in
The amino acid sequences of
From the above comparison, it would be apparent to one of skill in the art that related proteins from other species can be identified and isolated by methods known in the art. The example above employed stringent screening conditions. Less stringent conditions, varying the concentration of salts, detergent, or the temperature during hybridization or washing, as known in the art, would lead to related clones from libraries containing sequences of any of a number of species. For example, in addition to the conditions described above, any of the following hybridization conditions can be used, in any combination, in methods to isolate DNA sequences related to the P50 or P45 sequences herein:
low stringency wash in a solution comprising approx. 0.45 M NaCI, approx. 0.045 M trisodium citrate, and approx. 0.1% SDS, at approx. 37° to approx. 42° C.;
hybridization buffer comprising approx. 0.75 M NaCI, approx. 0.15 M Tris, approx. 10 mM sodium pyrophosphate, approx. 0.075 M trisodium citrate, and approx. 50% formamide;
hybridization buffer comprising approx. 5× SSC, approx. 5× Denhardt’s, approx. 5% Dextran Sulfate, approx. 50% formamide, and approx. 0.1 mg/ml ssDNA;
hybridization wash comprising approx. 0.1 M phosphate, approx. 0.1 × SET, approx. 0.1% sodium pyrophosphate, and approx. 0.1% SDS at approx. 45° C.
The absorbance spectrum of purified
Up to this point, flavoproteins have not been directly implicated as part of the replication machinery. The potential involvement of a flavoprotein in PCR enhancement suggests a role for redox reactions. The only redox reaction involved in DNA synthesis is the formation of deoxyribonucleotides from ribonucleotides, which is catalyzed by ribonucleoside diphosphate reductase. In vitro, the ribonucleoside diphosphate reductase enzyme can be coupled to NADPH via two known pathways involving FAD-containing oxidoreductases (Pigiet and Conley, J. Biol. Chem. 252:6367-72 (1977); Thelander and Reichard, Ann. Rev. Biochem. 48:133-158 (1979)). One pathway involves thioredoxin and thioredoxin reductase. Interestingly,
The nucleotide sequence of the Pfu P45 protein component was obtained as described below.
Amino terminal peptide sequencing of purified P45 protein allowed the generation of four degenerate oligonucleotides designed to hybridize to DNA encoding the PDWKIRKE (SEQ ID NO.:69) peptide of SEQ ID NO.: 11, as follows:
A lambda phage
10 μl 10× Stratagene cloned Pfu buffer
5 μl degenerate P45 primer (either #743, 744, 745 or 746) at 100 ng/μl
2.0 μl either reverse or −20 primer (100 ng/μl)
0.8 μl 100 mM dNTP (total dNTPs)
0.5 μl Taq DNA polymerase (Stratagene, 5u/μl)
0.5 μl Taq Extender (Stratagene, 5u/μl)
3.0 μl Pfu genomic library (˜1.2×10
78.2 μl H
PCR cycling was carried out in a RoboGradient temperature cycler as follows: One cycle at 95° C. for 3 minutes, followed by 30 cycles of: 95° C. for 1 minute; 51° C. to 65° C gradient for 2 minutes; 72° C. for 6 minutes.
The PCR products were separated on a 1% agarose, 1× TBE gel. All primer combinations produced multiple bands. A pattern of four bands was consistently seen with primers 743, 744, and 746 in conjunction with the −20 primer. The three degenerate primers that formed consistent four band patterns with the −20 primer were able to generate the pattern at 56° C. Only primer 743 could generate the pattern at 58° C. The band pattern produced with the degenerate primers in combination with the reverse primers was less distinct and formed only at lower annealing temperatures than the products generated with the −20 primer.
Two strategies were used to isolate the P45 clone. One procedure was to make simplified sub-libraries of the original highly complex library and screen for an insert with the −20 and 743 primers. Positive sub-libraries could be diluted and rescreened until individual plaques containing the appropriate insert were identified. The other technique was to make use of Vectorette™ technology (Genosys Biotechnologies), which allows PCR amplification when the sequence of only one end of a DNA fragment is known. In the vectorette system, genomic DNA is digested with a selection of specific restriction endonucleases. After digestion, the ends of the genomic DNA are ligated to specific vectorette units, which have the same cohesive termini as the genomic DNA digestion. The ligated vectorette unit contains a sequence complimentary to a provided vectorette PCR primer. (Arnold and Hodgson, PCR Methods and Applications 1: 39-42 (1991).)
Fifty μl reactions containing 100 ng of
The ligated DNA was amplified according to the following:
10 μl cloned 10× Stratagene Pfu buffer
8.3 μl degenerate P45 primer at 100 ng/μl
2.0 μl 50 pmol/μl vectorette primer
0.8 μl 100 mM (total) dNTP
0.5 μl Taq DNA polymerase (Stratagene, 5u/μl)
0.5 μl Taq Extender (Stratagene, 5u/μl)
1.0 μl vectorette library
76.9 μl H
PCR cycling was carried out as follows: One cylce at 95° C. for 1 minute followed by 30 cycles of: 95° C. for 1 minute; 56° C. for 2 minutes; and 72° C. for 3 minutes.
Ten μl were loaded on an 1% agarose, 1× TBE gel. Multiple bands were produced by all primers except 745. To determine if all three vectorette library products had been correctly primed off the same target DNA (P45 sequence) rather than having been produced by a non-specific PCR reaction, the products were digested with Mnl l. Mnl l cleaves at a frequent four base pair recognition sequence and produces a useful pattern of bands specific to the template digested. The pattern generated by electrophoresis of the Mnl l digestion fragments of the CIa {fraction (1/743)}, Hind III/744 and Eco Rl/744 PCR products on a 6% acrylamide gel showed some variation, but the majority of bands could be identified in all three samples, indicating that they share large segments of identical sequence.
The PCR products from the Cla l/743 and Hind lll/744 combinations were mixed and purified from free nucleotides and unused primers before being used as template for the generation of a 52 million cpm
More than 60 positive clones resulted from screening with the mixed vectorette probe. Several positive were well situated for collection without significant contamination from adjoining plaques. Twelve of these plaques were subjected to PCR amplification with the 743 and −20 primer as described previously except that an annealing temperature of 56° C. was used instead of a temperature gradient. In the same amplification assay, 11 sub-libraries were assayed in the same manner.
Three of the twelve clones recovered from the primary radioactive label screen produced strong, single bands. Clone 1 produced a band of approximately 5 kb, clone 3 produced a band of approximately 3.5 kb, and clone 9 generated a band of approximately 2.7 kb. One of the sub-libraries also produced a clone of approximately 6.5 kb.
Sequencing of the P45 clones was carried out on purified PCR products and plasmid mini-preps made from excised cells. The nucleotide sequence of P45 is listed below with the predicted amino acid translation. The chemically-determined N-terminal sequence of P45 (SEQ ID NO.: 11), used to generate the degenerate PCR primers (SEQ ID NO.: 32-35), is indicated by underlining.
The translated P45 protein has a theoretical pl of 9.12 and a calculated molecular weight of 17868.76. The translated N-terminal sequence (underlined) of P45 corresponds to the experimentallyetermined sequence (SEQ ID NO.: I11) and matches the exact sequence (SEQ ID NO.: 60) used to design the degenerate PCR primers.
When the P45 DNA sequence is translated in all six frames and compared to multiple sequence databases using the computer-implemented program Blastx, the dCTP deaminase gene of
When the P45 DNA sequence was compared to multiple databases using the program BlastX, the probable deoxycytidine triphosphate deaminase (dCTP deaminase) gene (dcd) of
In addition to dCTP deaminase,
One of the regions of sequence similarity between P45 and dUTPase is the putative uridine-binding motif. This motif is conserved in the translated amino acid sequence of
Each of these proteins represent activities, such as dUTPase, that may be used as a polymerase enhancing activity or PEF. One skilled in the art can identify Lnumerous other proteins using stored sequence information, in the appropriate computer readable medium, from this disclosure and analogous searching procedures in other databases. Database information on each of the following species can specifically be used to identify PEF using one or more of the sequences, or parts thereof, identified herein:
The physiological function of dCTP deaminase has only been studied in
Thus, dCTP deaminase and dUTPase are functionally linked, with mutations in the
dUTPase has shown to be an essential gene in
The substrate specificities, enzyme activities, and physiological role of dCTP deaminase and dUTPase had not been characterized in archea prior to this disclosure.
Recombinant P45 was produced by PCR amplification of a portion of a P45 genomic clone (clone #9). The primers (oligos #1 and 2 below) were designed to function with the Affinity Protein Expression and Purification System (Stratagene; La. Jolla, Calif.), which uses Ligation Independent Cloning (LIC).
The bold letter segments represent sequences specific to the cloning vector while the adjoining sequence is specific to the clone #9 sequence. The ATG underlined in oligo #1 corresponds precisely to the 5′ end of the P45 gene, while the sequence after the bold letters in oligo #2 corresponds to the end of the genomic insert.
The PCR amplification was carried out in a volume of 100 μl containing: 1× Cloned Pfu Polymerase Buffer, 0.2 mM dNTPs (each); 200 ng of Primer oligo #1; 200 ng of Primer oligo #2; 3 μl Genomic clone #9 plaque core in 500 μl SM buffer (˜2000 Lambda particles); 2.5 units Cloned Pfu DNA Polymerase; and 7 ng Native PEF (where 10× Cloned Pfu Polymerase Buffer is: 100 mM KCI; 100 mM (NH
The thermocycling parameters were: 95° C. for 1 minute (1 cycle); 95° C. for 1 minute −56° C. for 1 minute −72° C. for 5 minutes (30 cycles).
The 2.5 kb amplified product was purified and then subjected to limited nucleotide excision in the presence of dATP. This protocol promotes removal of nucleotides at the 3′ termini of the PCR product until an adenine residue is reached. The excision mixture (consisting of: 1× Cloned Pfu Polymerase Buffer, 0.5 mM dATP; 43.5 μl PCR product (8.7 ng/μl); 1.25 units Cloned Pfu DNA polymerase) was incubated at 72° C. for 10 minutes.
20 μl of the exonuclease treated PCR product was annealed with 40 ng of digested pCAL-n-EK vector (exonuclease treated to produce ends complimentary to the sequence exposed in the PCR product) for 45 minutes at room temperature. The amount of insert molar excess, relative to vector, was approximately 9 fold. The pCAL-n-EK vector contains an upstream, in-frame calmodulin binding peptide tag, which allows the N-terminal fusion protein to be easily purified on calmodulin agarose (CAM agarose). Various other expression vectors, which may or may not produce fusion proteins, are known in the art and can be used to express P45 protein or fragments thereof or to produce DNA constructs with a sequence encoding P45 protein or fragments thereof. An expression vector need only contain DNA sequences operating to permit or control transcription from an appropriately linked nucleic acid. The type of control, the degree of transcription permitted, and the manor in which the vector and nucleic acid are appropriately linked may vary. Generally, an expression vector also contains a replication control sequence to allow the vector to replicate in a host. However, replication control sequences are not required where replication of the host is not crucial to expression.
Five microliters of the annealed vector/insert DNA was transformed into XL2-Blue competent cells. Ten of the resultant colonies were screened by PCR for the 2.5 kb insert and 9 were found to contain the correct size insert. Plasmid DNA was prepared from three clones and then used to transform BL21 (DE3) cells. Six BL21 (DE3) colonies were grown for approximately 10 hours in 5 ml of 1× LB, 125 μg/ml ampicillin at 37° C. These cultures were used to inoculate six flasks containing 250 ml 1× LB and 125 μg/ml ampicillin. When the optical density (OD
250 μl of 10 mg/ml lysozyme was added to the cells and the reaction was allowed to incubate on ice for one hour. The slightly lysed samples were sonicated twice with the Branson Sonifier 250, the microtip at a duty cycle of 50% and a setting of 4. The lysate was cleared by superspeed centrifugation. Cleared lysate was added to 700 μl of washed Stratagene Calmodulin agarose (50% CAM agarose by volume) and allowed to bind with gentle rocking at 4° C. for 1 hour. The resin was washed 3 times with 10 ml of CaCI
Subsequent SDS-PAGE analyses showed that the high salt elution buffer released a majority of the recombinant
The method described here to produce P45 protein can be modified in numerous ways by methods known in the art (Ausubel, F. M., et al. (1989) Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Interscience, New York, N.Y.; Sambrook, J., et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) In one possible modification, a P45 analog protein can be produced.
For example, a mutation can be introduced into the P45 coding region. Any type of mutation can be used including site-specific point mutation, deletion mutation, insertion mutation, and multiples or combinations of these mutations. This mutant coding region is inserted into an appropriate vector, which is transferred into a host cell. The host cell then expresses the P45 analog. A P45 analog protein substantially retains one or more of the PEF activity or dUTP or dCTP metabolic activities described herein. Thus, the fusion protein and affinity tag expression and purification system described here is only one of many ways to produce a recombinant PEF protein such as recombinant P45.
Analogs may be constructed by, for example, making various substitutions of residues or sequences or deleting terminal or internal residues or sequences not needed for biological activity. For example, cysteine residues can he deleted or replaced with other amino acids to prevent formation of unnecessary or incorrect intramolecular disulfide bridges upon renaturation. Other approaches to mutagenesis involve modification of adjacent dibasic amino acid residues to enhance expression in yeast systems in which KEX2 protease activity is present. Other mutations can be made that favor expression in various host cells.
Typically, substitutions may be made conservatively. For example, one may substitute amino acids that have physiochemical characteristics resembling those of the residue to be replaced. Similarly, when a deletion or insertion strategy is adopted, the potential effect of the deletion or insertion on biological activity should be considered. In order to preserve the biological activity, deletions and substitutions will preferably result in homologous or conservatively substituted sequences, meaning that a given residue is replaced by a biologically similar residue. Examples of conservative substitutions include, but are not limited to, substitution of one aliphatic residue for another, such as lle, Val, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; Glu and Asp; or Gln and Asn. In view of this specification, one skilled in the art will be able to make other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics
Mutations in nucleotide sequences constructed for expression of an analog, in most instances, should preserve the reading frame phase of the coding sequences and preferably will not create complementary regions that could hybridize to produce secondary mRNA structures such as loops or hairpins which would adversely affect translation of the receptor mRNA. Although a mutation site may be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, in order to select for optimum characteristics of mutants at a given site, random mutagenesis may be conducted at the target codon and the expressed mutants or analogs screened for the desired activity.
Not all mutations in the nucleotide sequence which encode the protein will be expressed in the final product For example, nucleotide substitutions may be made to enhance expression, primarily to avoid secondary structure loops in the transcribed mRNA (see EPA 75,444A, incorporated herein by reference), or to provide codons that are more readily translated by the selected host, e.g., the well-known
Mutations can be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion.
Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required. Exemplary methods of making the alterations set forth above are disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, Jan. 12-19, 1985); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Pat. Nos. 4,518,584 and 4,737,462, which disclose suitable techniques, and are incorporated by reference herein.
The 5.2 kb “On/Off” assay, described in example 1, was used to demonstrate that recombinant P45 (rP45) possesses PEF activity comparable to a natural PEF.
The results are shown in FIG.
The predicted molecular weight of the translated rP45 DNA sequence was 18.6 kDa. However, the native P45 component migrates as part of the PEF complex at 300 kDa without heat denaturation, and at 45 kDa with heat denaturation (99° C. for 5 minutes, partially denatured). Protein complexes in hyperthermophiles are unusually stable and sometimes require extreme conditions before disassociation occurs. We have found that P45 migrates at approximately 18 kD, or approximately 17-18 kD, instead of 45 kD when the native PEF complex is boiled in the presence of 2% SDS and 1% trichloroacetic acid (TCA) (fully denaturing conditions)(FIG.
The migration differences between the fully denatured forms of the native (18kD) and recombinant P45 (26 kD) might be explained by differences in post-translational modifications between
The similarity of P45 to dCTP deaminases prompted us to test whether dCTP or other nucleotide triphosphates were substrates of PEFIP45. PEF was incubated with dCTP or dUTP and the reaction products were separated by reverse phase HPLC. Reaction mixtures (50 μl) containing 1× cloned Pfu polymerase buffer, 10 mM dCTP or dUTP, and 700 ng PEF (or 5 μl of cloned p45 (˜100 ng) or nothing (neg. control)) were incubated at 72° C. for 1 hour. The samples were injected on a 3.9×250 cm Waters Delta-pak C-1 8 column (300 angstrom/15 μm), equilibrated in 50 mM triethylammonium acetate, pH(7.0) (A). Products were eluted with acetonitrile (B) at 2 ml/min. using the following gradient: 0% B for 5 minutes, 0-10% B over 20 minutes. Absorbence of the eluate was monitored with a photodiode array detector, and peak areas were integrated at 260 nm.
The data in
In addition to dUTP, dCTP was also found to serve as a substrate for PEF (FIG.
The substrate preference and reaction catalyzed by PEF/P45 was significantly different from that predicted based upon the amino acid similarity to dCTP deaminases. Although both enzymes bind dCTP and dUTP, the forward reaction catalyzed by dCTP deaminase is the deamination of dCTP to produce dUTP+NH
We tested whether inorganic pyrophosphate (PP
In experiments to investigate whether PP
The temperature optimum (T
The enzyme activity of three different preparations of S200-purified native PEF was measured at 85° C. Protein concentrations were determined by both Bradford and by amino acid analysis. Shown below is a summary of the enzyme activity and specific activity (protein concentration determined by Bradford or AAA as indicated) of S200-purified native PEF. These activites were compared to the minimum amount of purified PEF required to amplify the 5.2 kb target in the “on/off” assay described in example 1 (100 μl PCR).
The data indicate that for purified PEF preps 1 and 2, there is an excellent agreement between dUTPase activity and PCR enhancing activity. However, native PEF prep 3 exhibited 2-4 times less PCR enhancing activity, possibly due to its lower specific activity. Prep 3 may contain contaminants, which interfere with PCR enhancement.
PPi formation from dCTP was also measured by substituting dCTP for dUTP. For native PEF prep 1, the level of dCTPase activity was found to 0.097(μmole PPi/hr/μl) at 85° C., which is 12-fold lower than the rate of PPi production from dUTP. In addition, recombinant P45 preparations were also tested and found to produce PPi from both dUTP and dCTP. Native PEF and recombinant P45 exhibited a similar degree of preference for dUTP, as compared to dCTP.
Therefore, recombinant P45 and structurally similar P45 proteins catalyze this reaction in the absence of any of the other components of the PEF complex. The methods described here for the PP
Electrospray mass spectral analysis was performed to characterize the byproduct of reactions employing PEF and dUTP. Analysis in the negative ionization mode produced a relatively clean spectrum exhibiting peaks at 307 and 615 m/e. These masses are consistent with those of dUMP [M-H] and its non-covalent dimer [2M-H]. Analysis in the positive mode gave a complex array of peaks.
An understanding of the catalytic activity of PEF/P45 has provided insight into the mechanism by which PCR enhancement occurs. Lasken et al. have reported that archeal DNA polymerases, such as Vent, incorporate dUTP at approximately 40% the rate of TTP (Roger S. Lasken, David M. Schuster, and a Ayoub Rashtchian, (1996)
One possible mechanism for the PCR enhancing activity of PEF/P45 is that its associated dUTPase activity may convert any dUTP present during PCR to dUMP, a side-product which should not interfere with DNA polymerase activity. By so doing, dUTP would not be available for incorporation into the PCR product, and hence dU-DNA inhibition of the DNA polymerase would not occur. Such a mechanism is consistent with the increased PCR product yields generated by archeal DNA polymerase in the presence of PEF/P45.
dUTP, however, is not intentionally added to PCR reactions but may be generated by spontaneous deamination of dCTP during the high temperatures used in PCR cycling (Jens-Peter Horst and Hans-Joachim Fritz, (1996) The
dUTP production was also measured during PCR cycling. A dCTP solution (10 mM dCTP in cloned Pfu DNA polymerase PCR buffer) was subject to PCR cycling in a RoboCycler 40 using the cycling conditions described for the 5.2 kb “on/off” system (example 1). Products generated during PCR were analyzed by HPLC as described above. After 30 cycles, the following products were evident: 79% dCTP, 19% dCDP, 1.8% dCMP, and 0.064% dUTP (
The increase in dCMP production in dCTP+PEF samples (8%) as compared to dCTP±Pfu samples (1.7-1.8%) shows that in addition to eliminating the minor dUTP deamination product during PCR, PEF will also convert dCTP to dCMP. In this experiment (50× PCR conditions), the final dCTP concentration post-PCR was 73% in PEF-containing reactions and 79% in those tacking PEF. This slight drop in the dCTP pool is not anticipated to affect PCR product yield or DNA polymerase replication fidelity significantly. However, it is anticipated that the use of higher amounts of PEF in PCR (>>1 ng per 100 μl reaction) will be deleterious due to dCTP reactivity. If high amounts of PEF are used, it is possible that the dCTP pool could fall below levels required for maximal yields and lowest misinsertion rates. As described elsewhere, we have observed inhibition of replication or amplification and/or smearing of products with the use of excessive amounts of PEF.
Although Lasken reported that the incorporation of dUTP in the nascent DNA strand only inhibited archael polymerases by 40% (Lasken, et al. (1996)
A relatively small (0.9 kb) fragment of the human a β1-antitrypsin gene was amplified in the absence or presence of dUTP. PCR reaction mixtures contained the following (in a 100 μl volume): 1× Cloned Pfu polymerase buffer; 200 μM each, dCTP, dGTP, dATP; 200 ng oligo F91-23 (100 ng/μl); 200 ng oligo R980-23 (100 ng/μl); 125 ng Human genomic DNA; 2.5 units Pfu DNA polymerase; 200 μM total of (dTTP and dUTP) or (dTTP+PEF generated dUMP).
PEF generated dUMP was prepared as described in Example 11, section 1, and purified by reverse phase HPLC.
PCR cycling was carried out as follows: 95° C. for 1 minute (1 cycle); 95° C. for 1 minute −58° C. for 1 minute −72° C. for 2 minutes (30 cycles).
The PCR products were examined on a 1% agarose, 1× TBE gel as shown in FIG.
Unlike dUTP, the PEF generated byproduct, dUMP, was not inhibitory in Pfu polymerase-based PCR reactions, even when present at concentrations of 20 μM. In
We also tested whether PEF/rP45 could reverse the inhibition caused by uracil-containing DNA. PCR amplification was carried out in the presence of a third unrelated primer, which contains 9 dUs instead of dTs (dU oligo). Primers complementary to M13 DNA were synthesized.
The 900 bp α1-antitrypsin fragment was amplified in the presence of the oligos, added at levels ranging from 200 ng (16 pmole) to 0.2 ng (0.016 pmole) per 100 μl reaction. In addition, similar reactions were performed with Taq DNA polymerase instead of Pfu DNA polymerase. In
The enhancement by PEF in the dU oligo-inhibited reaction could be achieved through at least two possible pathways. The most likely explanation is that PEF is having no effect on the dU containing oligonucleotides and is simply increasing the activity of Pfu DNA polymerase by scavenging dUTP generated during PCR by heat- or chemically-induced deamination of dCTP (eg., lanes 2 and 3 of FIG.
The knowledge of potential PEF mechanisms of action described here allows those skilled in the art to employ other dUTP modifying enzymes in enhancing polymerase reactions. A definition or one of these other modifying enzymes can be an enzyme that diminishes the capacity to incorporate dUTP by polymerases or at least partially inhibits dUTP incorporation. Assays used to identify and characterize PEF as described herein can also show other dUTP modifying enzymes. These other modifying enzymes could also mimic the enhancing attributes of PEF or a particular protein, such as P45 or rP45. An example of this class of enzyme would be dUTP pyrophosphatases (EC 3.6.1.23), such as deoxyuridine 5′-triphosphate nucleotide hydrolase, as well as other enzymes involved in dUTP metabolism, catabolism, or synthesis. These other enzymes may be used alone or in combination with PEF or other proteins or enhancing additives.
Furthermore, the presence of the consensus uridine-binding motif or the related sequences shown herein can also be used to define an enzyme or protein that is a PEF. Thus, a protein the comprises SEQ ID NO.: 72, or any one of SEQ ID NOs.: 72-81, or combinations of these sequences, may be a PEF according to this invention.
The structural information, in the amino acid and nucleotide sequences, as well as the functional information described here allow one skilled in the art to identify polymerase enhancing andlor dUTPase activities from a variety of sources. For example, we have shown above how degenerate probes made from the amino acid sequences of P50 and P45 can be used to clone nucleotide sequences encoding polymerase enhancing and dUTPase activities, orPEF. Since we have identified the importance of dUTPase activity in controlling and enhancing polymerase reactions, such as PCR, structural information available for any dUTPase can be put to a new and advantageous use in identifying and producing proteins for enhancing polymerization reactions. Furthermore, the assays described can be used to identify the presence of dUTPase activity from any source.
To determine if other enzymes with dUTPase activity could also produce polymerase enhancing activity, we cloned a representative eukaryotic protein, human dUTPase. Total RNA was isolated from human placenta and converted to cDNA as follows: 5 μl total human RNA, 5 μl oligo dT (0.1 μg/μl), 1 μl Moloney murine leukemia virus reverse transcriptase (40 u/μl), 1 μl 1 100 mM dNTPs, 5 μl 10 × first strand buffer, 33 μl DEPC-treated water (where 1x first strand buffer is 50 mM Tris-HCL (pH 8.3), 75 mM KCI, 10 mM DTT, and 3 mM MgCI
Primers containing a sequence specific to the 5′ and 3′ termini of one of the human dUTPase genes were synthesized and are shown below. The accession numbers for the cDNA sequence of Human deoxyuridine triphosphatase (DUT) are gi|1421817|gb|U62891|HSU62891. These primers also shared sequence with the vector pCAL-n-EK (in bold print below), which allowed ligation independent cloning (LIC) of the amplified product, as described in Example 10.
Prior to PCR, the reverse transcriptase was heat inactivated by incubating the reaction at 80° C. for 5 minutes. The dUTPase sequence was amplified in a 100 μl reaction containing 1× cloned Pfu polymerase buffer, 200 ng of each primer, 200 μM dNTPs, 2.5 units of Pfu DNA polymerase, 3 ng of PEF complex and 3μl of human placenta CDNA from the previous section.
The reactions were amplified under the following conditions: 95° C. for 3 minutes (1 cycle); 95° C. for 1 minute −50° C. for 1 minute −72° C. for 2 minutes (30 cycles). The amplified reaction was examined on a 1% agarose gel to confirm that the product exhibited the correct size before purification. The purified product was cloned into the expression vector pCAL-n-EK, as described in Example 10, and transformed into XL1 -Blue cells. Three clones were confirmed to contain human dUTPase by sequencing of the first 500 bases. After the transformants were shown to contain the dUTPase sequence by PCR amplification, their plasmids were harvested and used to transform the
The BL21/dUTPase clones were induced with IPTG and the expressed protein was purified by means of the calmodulin binding peptide (CBP) tag expressed as a fusion protein at the amino terminus of the dUTPase sequence. The fusion protein was purified on calmodulin agarose, as described in example 10. The protein products were analyzed by SDS-PAGE and found to be of the correct molecular weight.
To confirm that the dUTPase clones were active, the Sigma pyrophosphatate assay (see Example 11) was utilized. The assay demonstrated that all of the clones tested could convert dUTP to dUMP+pyrophosphate. The human dUTPase enzyme was thermolabile and became completely inactive after a one minute pre-incubation at 70° C.
Polymerase enhancement was also detected with the 5.2 kb on/off assay. The assay was modified from the protocol described in Example 1 to allow detection of the thermolabile PEF activity. A PCR cocktail was mixed to provide an identical starting point for all samples. Ninety-nine microliters of the cocktail was aliquoted into six thin-walled, 0.5 ml tubes. The reactions contained 278 ng of human genomic DNA, 200 ng of each primer (see Example 1), 200 μM each dNTP, 2.5 units of Pfu DNA polymerase in 1× cloned Pfu polymerase buffer. At each 60° C. annealing step, 0.5 μl of one the following were added: human dUTPase preparation, a {fraction (1/10)}th dilution of the human dUTPase preparation, 2 ng/μl rP45 (positive control), or dUTPase storage buffer (negative control). Both human dUTPase reactions were run in duplicate. The samples were cycled as follows: 95° C. for 1 minute (1 cycle); 95° C. for 1 minute −60C. for 1 minute −72° C. for 5.2 minutes (30 cycles).
10 μl of each PCR reaction was visualized on a 1 % agarose, 1× TBE gel by ethidium bromide staining. (See
PEF-specific IgG was purified by immunoaffinity chromatography from the sera of rabbits previously immunized against a lot of native Pfu DNA polymerase containing PEF (see
In addition, sera containing rP45-specific IgG was obtained by immunizing rabbits with recombinant P45, which was prepared as a tagged fusion protein, as described in example 10, section 2. The purified enzyme (0.177 mg/ml) was used to immunize two New Zealand white rabbits using the following immunization schedule: 90 μg/rabbit in Complete Freund’s Adjuvant (CFA); 18 days later, boost with 45 μg/rabbit in incomplete Freund’s adjuvant (IFA); 39 days later, second boost; 45 days later, obtained serum sample for Western blot.
Cell extracts were prepared by suspending cells in 4×50 mM Tris, pH 8.2, 10 mM BME, 1 mM EDTA, and 10% glycerol, followed by sonication. Then, 2.5 mM PMSF was added and the cellular debris removed by centrifugation for 15 minutes at 14,000 rpm. PEI was added to the supematant to a final concentration of 0.9% and the mixture centrifuged again. The supematants (10 μl) were electrophoresed on 4-20% SDS-PAGE gels and the proteins transferred to nitrocellulose by electroblotting. The blots were blocked with 1% Blotto/PBS for 1 hour at room temperature and then incubated with PEF-specific IgG overnight at 4° C. The blots were washed in PBS-0.05% Tween 20, and then incubated with alkaline phosphatase-conjugated goat anti-rabbit IgG. The blot was washed and then incubated in color development solution (100 mM Tris-HCI, pH 9.5, 100 mM NaCI, 5 mM MgCI
Native PEF samples were electrophoresed on a 4-20% gradient Tris-Glycine SDS gel. The samples were loaded without denaturation (P300 form) or after partial (boiling in 2%SDS; P45 form) or complete (boiling 2%SDS plus 1%TCA) denaturation. The samples were transferred to nitrocellulose and the blots developed as described above, except that sera from rabbits immunized with recombinant P45 was used (diluted: 1:000).
In
As with the PEF-specific IgG from above, anti-rP45 sera can also be used to i z identify immunochemically-related proteins from other species. In
In a separate Western assay, samples from
Initially and as a control to confirm the activity of the DNA polymerase used, gapped-duplex calf thymus DNA (Pharmacia) assays were performed. The polymerase cocktail contained 50 mM Tris-HCI, pH 8.0, 5 mM MgCI
The PEF samples tested exhibit no significant DNA polymerase activity while the Pfu DNA polymerase exhibited a specific activity of 2-4×10
The most dramatic enhancements were observed when long (
Subsequent to identifying PEF from
Contamination of native Pfu DNA polymerase with varying amounts of PEF could potentially contribute to lot-to-lot variation in the performance of native Pfu DNA polymerase in PCR. It is expected that lots containing approximately 1-100 ng of PEF per 2.5 U of Pfu DNA polymerase will give rise to higher PCR product yields than amplifications conducted with cloned Pfu DNA polymerase or native Pfu DNA polymerase lots contaminated with ≦10 pg per 2.5 U Pfu DNA polymerase (<0.02 % total protein). In theory, a lot containing certain PEF concentrations would exhibit reduced Pfu DNA polymerase performance, based upon the apparent inhibition of PEF at high concentrations discussed below (>900 ng per 2.5 U Pfu DNA polymerase in 100 μl PCRs).
When adding PEF to native Pfu DNA polymerase PCR amplifications, it is anticipated that the level of PEF contained in a particular lot of native Pfu must be taken into account to avoid smearing, inhibition of synthesis, or sub-optimal enhancement.
To enhance PCR product yield,
In
The addition of
In the 2-step RT-PCR procedure, cDNA synthesis is first performed by combining the following reagents (50μl final volume): 5μl total RNA pre-annealed to 300 ng of primer (oligo dT, random hexamers, or a gene-specific primer), 4 mM each dNTP, 20 U RNase block (optional), and 50 U MMLV RT (or other RT) in buffer containing 50 mM Tris-HCI (pH 8.3), 75 mM KCI, 3 mM MgCI
The enhancement of RT-PCR with
The PEF concentration which gives optimal performance was determined by titrating PEF preparation 3 (S-200 purified) and preparation 4 (heparin sepharose fraction) in the 2-step RT-PCR procedure described here. With PEF preparation 4, significant increase in the yield of the 1 kb product was observed when 0.001-1 μl was added (10 pg-10 ng PEF) (FIG.
With PEF preparation 3, significant increases in the yields of both the 0.6 kb and the 3 kb products were observed for all amounts tested in the range of 0.002-0.1 μl (1-50 ng).
Seamless Cloning was performed using Stratagene’s Seamless™ Cloning kit (Stratagene; La Jolla, Calif., 1997/1998 Stratagene Catalog, specifically incorporated herein by reference), following the recommended protocol. The effect of
Increased yield of a 7.2 kb PCR product was observed when 5 ng of S-200 purified PEF (prep. 1) was added to 50 μl PCR reactions containing 2.5 U Pfu DNA polymerase and methyl dCTP. Amplifications conducted in the presence of PEF utilized 1 min. per kb extension times. In the absence of PEF, very little PCR product was generated despite the use of longer 2 min./kb extension times.
Site-specific mutagenesis can be accomplished efficiently with double-stranded DNA templates using a linear amplification-based strategy employing Pfu DNA polymerase (QuikChange™ Site-Directed Mutagenesis Kit; Stratagene; La Jolla, Calif., 1997/1998 Stratagene Catalog, specifically incorporated herein by reference). PCR primers containing the desired mutation(s) are designed to anneal to the same site on opposite strands. Primer extension reactions are conducted with a thermostable DNA polymerase (e.g. Pfu DNA polymerase) at temperatures which allow efficient synthesis in the absence of strand displacement activity (68° C.). The amplification product is treated with Dpnl to digest the parental methylated plasmid DNA and the resulting gapped, double-stranded DNA is then transformed into competent
In evaluating
The use of PEFs in the QuikChange™ mutagenesis protocol corresponds to the use of PEFs in other linear amplification reactions known in the art, such as cycle sequencing reactions, primer extension reactions, and the like. PEFs can be employed in any linear amplification method to enhance the activity of the polymerase used. For example, the effect of Pfu PEF on cycle sequencing can be evaluated by comparing the quality and length of sequencing ladders generated with a polymerase, for example exoPfu DNA polymerase, in the absence and in the presence of PEF. A number of different cycle sequencing reactions, known to one skilled in the art, can be used in combination with the PEF complexes and proteins of this invention to enhance polymerase activity. In addition, primer extension reactions can also be enhanced with the use of PEFs. Numerous primer extension reactions are known in the art.
The nucleic acid replication enhancing activity of several different preparations of Pfu PEF have been evaluated in PCR, PCR-related applications, linear amplification-based applications, mutagenesis applications, cycle sequencing applications, and primer extension applications. One skilled in the art will appreciate that similar methods to optimize the use of any PEF, such as those specifically discussed herein, are apparent from the disclosure herein. A sample of substantially homogeneous PEF (e.g. S200-purified) enhances the performance of Pfu DNA polymerase in PCR amplification reactions when added at concentrations spanning a 10,000-fold range (0.09-900 ng/100 μl). The highest yields of amplified product are observed in the presence of ≈1 to 100 ng of P50. The addition of excess PEF (≧900 ng/100 μl, where protein concentration was determined by the silver-staining intensity of the P50 band as compared to known protein standards) or very low PEF concentrations (<9 pg/100 μl) in a PCR reaction resulted in lower PCR product yield.
The relative purity and PEF content of 4 preparations was examined by SDS-PAGE analysis (FIG.
The PCR enhancing titer of S200-purified
The PCR enhancing titer of PEF preparation 2 was also determined (FIGS.
In summary, sunstantially homogeneous
Inhibition of PCR enhancement at high concentrations of PEF appears to occur irrespective of the purity of the PEF sample. The addition of higher concentrations of homogeneous PEF (≧900 ng) resulted in lower yields of PCR product than could be obtained with <900 ng PEF. Heparin sepharose fractions of 10-20% purity also gave reduced PCR product yields when high amounts of PEF were added. Up to 8 ng of PEF in prep. 2 (H.S. #78 fraction) could be added before smearing or inhibition occurred. The discrepancy between the amount of PEF which is inhibitory in homogeneous preparations (≧900 ng), as compared to partially-purified column fractions (>16 ng), suggests that additional protein or DNA contaminants may be present in the heparin sepharose fractions.
Examination of heparin sepharose fractions revealed that
As observed with PCR, inhibition during linear amplification protocols was noted with high concentrations of PEF-containing heparin sepharose fractions (FIG.
A possible and the most likely explanation for inhibition by homogenous PEF preparations is depletion of dCTP. In Example 11, section 1, we demonstrated that PEF can utilize dCTP as a substrate, although much less efficiently than dUTP. At high PEF concentrations it is possible that enough dCTP is hydrolyzed by PEF to drop the dCTP levels below what is required for optimal DNA synthesis. It is also possible that moderate to high levels of PEF could alter dCTP levels enough to affect DNA polymerase misincorporation rates. Alternatively, contaminants in the substantially homogenous PEF preparations may also cause the inhibition and may only be present in sufficient concentrations when high concentrations of PEF are used.
Each of the references referred to herein can be relied on by one skilled in the art in making and using embodiments of the invention. In addition, each reference is specifically incorporated, in its entirety, into this disclosure.
The sequence listing information that follows incorporates the sequences in prior U.S. Patent application Ser. No. 08/822,744, which is specifically incorporated herein by reference. The sequence information from any one sequence or any combination of sequences can be translated into a computer readable medium by those of skill in the art. Furthermore, the sequences of the specific clones or plasmids described or identified herein can be easily determined and used in a computer readable medium by one skilled in the art.
原文链接：https://www.freepatentsonline.com/6734293.html
